ID: 1091407153_1091407158

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1091407153 1091407158
Species Human (GRCh38) Human (GRCh38)
Location 12:216196-216218 12:216223-216245
Sequence CCTCACTCAAGTTCTCCTAGCCT GACCCACTTGGTATTCAGACTGG
Strand - +
Off-target summary {0: 6, 1: 1, 2: 1, 3: 15, 4: 169} {0: 2, 1: 2, 2: 0, 3: 8, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!