ID: 1091407196_1091407205

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1091407196 1091407205
Species Human (GRCh38) Human (GRCh38)
Location 12:216481-216503 12:216526-216548
Sequence CCTCACTCAAGTTCTCCTAGCCT ACTGGTTAGTAAACCCCTGGAGG
Strand - +
Off-target summary {0: 6, 1: 1, 2: 1, 3: 15, 4: 169} {0: 1, 1: 2, 2: 1, 3: 5, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!