ID: 1091407885_1091407907

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1091407885 1091407907
Species Human (GRCh38) Human (GRCh38)
Location 12:220470-220492 12:220515-220537
Sequence CCCGCCCCCATCACCGTGCTGAG GGGGGAGGCTAGGATGGGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 288} {0: 1, 1: 0, 2: 6, 3: 118, 4: 1192}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!