ID: 1091410696_1091410700

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1091410696 1091410700
Species Human (GRCh38) Human (GRCh38)
Location 12:237347-237369 12:237362-237384
Sequence CCCCGTCCTGGGACAGTGGAGCT GTGGAGCTGAGCCTGCCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 148} {0: 1, 1: 0, 2: 3, 3: 35, 4: 390}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!