ID: 1091415137_1091415142

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1091415137 1091415142
Species Human (GRCh38) Human (GRCh38)
Location 12:276318-276340 12:276368-276390
Sequence CCTTCAGGTTATCTGTTGCATGT TGCTGTGTATGGAGGGATAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 133} {0: 1, 1: 0, 2: 2, 3: 20, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!