ID: 1091440008_1091440021

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1091440008 1091440021
Species Human (GRCh38) Human (GRCh38)
Location 12:505392-505414 12:505427-505449
Sequence CCCCCTTTCCTCTGTTCCCACTG CTGGACTCCCTAAGCCCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 85, 4: 733} {0: 1, 1: 0, 2: 4, 3: 13, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!