ID: 1091443018_1091443027

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1091443018 1091443027
Species Human (GRCh38) Human (GRCh38)
Location 12:526392-526414 12:526443-526465
Sequence CCTGTCCCAGGCCAGAAAGAAGA AAAAGTCAGTACTGACCTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 296} {0: 1, 1: 0, 2: 3, 3: 30, 4: 242}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!