ID: 1091446729_1091446739

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1091446729 1091446739
Species Human (GRCh38) Human (GRCh38)
Location 12:548017-548039 12:548058-548080
Sequence CCGCCAGCCTGTCAGCCTCCCAC CTGCACAAGCAGAATGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 128, 4: 706} {0: 1, 1: 1, 2: 4, 3: 30, 4: 317}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!