ID: 1091490682_1091490691

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1091490682 1091490691
Species Human (GRCh38) Human (GRCh38)
Location 12:929965-929987 12:930015-930037
Sequence CCACCTACCTTACCTCCTCACCC AGTGCAGAAGTCCCCACTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 66, 4: 730} {0: 1, 1: 0, 2: 1, 3: 27, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!