ID: 1091490919_1091490921

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1091490919 1091490921
Species Human (GRCh38) Human (GRCh38)
Location 12:931924-931946 12:931959-931981
Sequence CCTGCTCAGATGAGATGAATACT CTAAAGACAAAGATGGAGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 94} {0: 1, 1: 0, 2: 1, 3: 16, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!