ID: 1091529066_1091529070

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1091529066 1091529070
Species Human (GRCh38) Human (GRCh38)
Location 12:1337114-1337136 12:1337152-1337174
Sequence CCTTAATCTTTGATCTAATACTG AGTCTCCCACTGTTATTGTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 160} {0: 79, 1: 1443, 2: 5271, 3: 5264, 4: 2011}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!