ID: 1091541416_1091541419

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1091541416 1091541419
Species Human (GRCh38) Human (GRCh38)
Location 12:1465944-1465966 12:1465980-1466002
Sequence CCAGGCTAATTCTGTTGCCACTG CATATCCTGATGTCTGGAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 197} {0: 1, 1: 0, 2: 0, 3: 20, 4: 359}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!