ID: 1091555049_1091555058

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1091555049 1091555058
Species Human (GRCh38) Human (GRCh38)
Location 12:1566745-1566767 12:1566798-1566820
Sequence CCCTCACCTTCTGGAGCTTCCCC CCCCTCGTGCCTCCTGCAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 339} {0: 1, 1: 0, 2: 2, 3: 18, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!