ID: 1091558672_1091558686

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1091558672 1091558686
Species Human (GRCh38) Human (GRCh38)
Location 12:1594424-1594446 12:1594466-1594488
Sequence CCGCGCCGCCGCGCCCACGCCCC CTGCCGCCGCCGCTGCTCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 185, 4: 1255} {0: 1, 1: 0, 2: 5, 3: 68, 4: 452}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!