ID: 1091558673_1091558691

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1091558673 1091558691
Species Human (GRCh38) Human (GRCh38)
Location 12:1594429-1594451 12:1594474-1594496
Sequence CCGCCGCGCCCACGCCCCCTGCC GCCGCTGCTCCGCGGGCCGGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 13, 3: 160, 4: 1281} {0: 1, 1: 0, 2: 2, 3: 20, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!