ID: 1091558678_1091558703

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1091558678 1091558703
Species Human (GRCh38) Human (GRCh38)
Location 12:1594444-1594466 12:1594494-1594516
Sequence CCCCTGCCGCATCCTCCGCCTCC CGGGCGGCGAGGGGGCCCCGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 29, 3: 215, 4: 2051} {0: 1, 1: 0, 2: 8, 3: 51, 4: 435}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!