ID: 1091558683_1091558701

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1091558683 1091558701
Species Human (GRCh38) Human (GRCh38)
Location 12:1594459-1594481 12:1594492-1594514
Sequence CCGCCTCCTGCCGCCGCCGCTGC GGCGGGCGGCGAGGGGGCCCCGG
Strand - +
Off-target summary {0: 2, 1: 6, 2: 59, 3: 308, 4: 1513} {0: 1, 1: 0, 2: 11, 3: 109, 4: 939}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!