ID: 1091560219_1091560227

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1091560219 1091560227
Species Human (GRCh38) Human (GRCh38)
Location 12:1606490-1606512 12:1606543-1606565
Sequence CCTTGTGTGCAGGAAATTAAAGA AAGTTGGAACAGCTTGCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 246} {0: 1, 1: 0, 2: 1, 3: 21, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!