ID: 1091563370_1091563375

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1091563370 1091563375
Species Human (GRCh38) Human (GRCh38)
Location 12:1630542-1630564 12:1630575-1630597
Sequence CCGGTGCAGCTGCTGGGCAAGGT GCCCTCGAGGACCACGGTGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 74, 4: 474} {0: 1, 1: 0, 2: 1, 3: 8, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!