|
Left Crispr |
Right Crispr |
| Crispr ID |
1091573674 |
1091573681 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
12:1713243-1713265
|
12:1713266-1713288
|
| Sequence |
CCTTTGGTATTTGAGAGAACAGG |
GTATAGGGCTTGGGTACAACTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 4, 2: 81, 3: 81, 4: 257} |
{0: 1, 1: 80, 2: 61, 3: 54, 4: 163} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|