ID: 1091585151_1091585159

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1091585151 1091585159
Species Human (GRCh38) Human (GRCh38)
Location 12:1811665-1811687 12:1811701-1811723
Sequence CCGCGTTGCCGCCCAGAATTTGC CAGCTTCATTTGGACGCCCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 44} {0: 1, 1: 0, 2: 0, 3: 1, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!