ID: 1091596403_1091596411

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1091596403 1091596411
Species Human (GRCh38) Human (GRCh38)
Location 12:1881808-1881830 12:1881858-1881880
Sequence CCCTTTAAAGTAGATTAATGAGC TTATGTCTACTATTAACAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 184} {0: 1, 1: 0, 2: 1, 3: 21, 4: 280}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!