ID: 1091599356_1091599365

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1091599356 1091599365
Species Human (GRCh38) Human (GRCh38)
Location 12:1908599-1908621 12:1908635-1908657
Sequence CCCCCAGGACTGCGTCACGGACA TCCCACGCCGGACTGCCTCACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 64} {0: 2, 1: 4, 2: 0, 3: 6, 4: 61}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!