ID: 1091606282_1091606286

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1091606282 1091606286
Species Human (GRCh38) Human (GRCh38)
Location 12:1954676-1954698 12:1954694-1954716
Sequence CCCAGTCTACAGTGCTAGCTCTG CTCTGCATCTGGCACAGAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 182} {0: 1, 1: 0, 2: 4, 3: 46, 4: 440}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!