ID: 1091622172_1091622174

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1091622172 1091622174
Species Human (GRCh38) Human (GRCh38)
Location 12:2097541-2097563 12:2097576-2097598
Sequence CCACATGATTGCCAATACTTGTT TTTCGATAATAGCCGTCCTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 75, 3: 553, 4: 1708} {0: 1, 1: 0, 2: 2, 3: 30, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!