ID: 1091622173_1091622174

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1091622173 1091622174
Species Human (GRCh38) Human (GRCh38)
Location 12:2097552-2097574 12:2097576-2097598
Sequence CCAATACTTGTTATTTTCTGATT TTTCGATAATAGCCGTCCTAAGG
Strand - +
Off-target summary {0: 4, 1: 39, 2: 270, 3: 765, 4: 2130} {0: 1, 1: 0, 2: 2, 3: 30, 4: 66}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!