ID: 1091626523_1091626526

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1091626523 1091626526
Species Human (GRCh38) Human (GRCh38)
Location 12:2125007-2125029 12:2125035-2125057
Sequence CCTGCATCAGGGTGGAGTGGGAG CAGTGACCACAGCCAGACCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 282} {0: 1, 1: 0, 2: 1, 3: 40, 4: 326}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!