ID: 1091628655_1091628665

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1091628655 1091628665
Species Human (GRCh38) Human (GRCh38)
Location 12:2141604-2141626 12:2141656-2141678
Sequence CCATAAGGGATGCAAGCTCCGTA GCTGCGAGGTTCCAGAAGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 37} {0: 1, 1: 0, 2: 0, 3: 8, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!