ID: 1091637813_1091637815

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1091637813 1091637815
Species Human (GRCh38) Human (GRCh38)
Location 12:2211263-2211285 12:2211286-2211308
Sequence CCACTTTCTTACACCTCACAGTA ACCATGTTCCAGCAGCTTATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 674} {0: 1, 1: 0, 2: 0, 3: 7, 4: 112}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!