ID: 1091650040_1091650053

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1091650040 1091650053
Species Human (GRCh38) Human (GRCh38)
Location 12:2302985-2303007 12:2303036-2303058
Sequence CCTGCATCACAGCAACAAGTGGG CCTTCTCCCAGGACGGAGGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 142} {0: 1, 1: 0, 2: 2, 3: 35, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!