ID: 1091650695_1091650704

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1091650695 1091650704
Species Human (GRCh38) Human (GRCh38)
Location 12:2307000-2307022 12:2307038-2307060
Sequence CCTCACCAAAACCAGAGCCCACT TGGTCTCAGCTGAAGCCATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 229} {0: 1, 1: 0, 2: 3, 3: 26, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!