ID: 1091656231_1091656243

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1091656231 1091656243
Species Human (GRCh38) Human (GRCh38)
Location 12:2348663-2348685 12:2348702-2348724
Sequence CCACACTTTAAGATTTCTCCCAG GGGCGCCCTGGAGAAGGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 201} {0: 1, 1: 0, 2: 11, 3: 156, 4: 1004}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!