ID: 1091656235_1091656252

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1091656235 1091656252
Species Human (GRCh38) Human (GRCh38)
Location 12:2348681-2348703 12:2348733-2348755
Sequence CCCAGAGGGACCCAGAGTGTGGG CGGGGGAAAGGTTCCTTCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 232} {0: 1, 1: 0, 2: 0, 3: 13, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!