ID: 1091670231_1091670238

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1091670231 1091670238
Species Human (GRCh38) Human (GRCh38)
Location 12:2447280-2447302 12:2447303-2447325
Sequence CCAAGGCAGCTGCCTCCCTAAAC CAATTTTATGGCACAAAAATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 222} {0: 1, 1: 0, 2: 2, 3: 28, 4: 336}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!