ID: 1091678539_1091678546

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1091678539 1091678546
Species Human (GRCh38) Human (GRCh38)
Location 12:2509638-2509660 12:2509665-2509687
Sequence CCCTCCTACGCATAGTGACACAG GCACTTCAGCATTATGCTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 83} {0: 2, 1: 40, 2: 80, 3: 129, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!