ID: 1091686033_1091686039

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1091686033 1091686039
Species Human (GRCh38) Human (GRCh38)
Location 12:2563397-2563419 12:2563422-2563444
Sequence CCTGGTGGCCTGCTTCCCTGTGT TGGATTTTCCCCCAAGTGGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 433} {0: 1, 1: 0, 2: 3, 3: 15, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!