ID: 1091689121_1091689132

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1091689121 1091689132
Species Human (GRCh38) Human (GRCh38)
Location 12:2583812-2583834 12:2583857-2583879
Sequence CCCCAGCCTGGGTTGCTGCGGCT AATGTCTGGGTGCCTGGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 48, 4: 428} {0: 1, 1: 0, 2: 2, 3: 38, 4: 403}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!