ID: 1091691323_1091691326

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1091691323 1091691326
Species Human (GRCh38) Human (GRCh38)
Location 12:2599340-2599362 12:2599359-2599381
Sequence CCGTGGCTGTCCAAGGGGGACAT ACATTTAGCACAAGGAACAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 138} {0: 1, 1: 0, 2: 5, 3: 27, 4: 254}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!