ID: 1091700332_1091700347

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1091700332 1091700347
Species Human (GRCh38) Human (GRCh38)
Location 12:2654837-2654859 12:2654890-2654912
Sequence CCTGTGTCCTGTCAGAAGCAGGA CCAGCTCCCACTGGGCTGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 280} {0: 1, 1: 0, 2: 3, 3: 30, 4: 303}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!