ID: 1091700337_1091700345

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1091700337 1091700345
Species Human (GRCh38) Human (GRCh38)
Location 12:2654867-2654889 12:2654889-2654911
Sequence CCCAGCATCCACCGCTCTCAGCC CCCAGCTCCCACTGGGCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 248} {0: 1, 1: 0, 2: 8, 3: 80, 4: 471}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!