ID: 1091704700_1091704711

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1091704700 1091704711
Species Human (GRCh38) Human (GRCh38)
Location 12:2685928-2685950 12:2685972-2685994
Sequence CCTGCCTCAAATCAGCCCCACAC GGAGACAACATTCCAAAGGCAGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 13, 4: 292} {0: 2, 1: 0, 2: 2, 3: 14, 4: 171}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!