ID: 1091719445_1091719449

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1091719445 1091719449
Species Human (GRCh38) Human (GRCh38)
Location 12:2801870-2801892 12:2801893-2801915
Sequence CCCTTCAGGGTCTTGGATGGTCC AGTGTATTGCGTCAAGGCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 105} {0: 1, 1: 0, 2: 0, 3: 1, 4: 45}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!