ID: 1091724054_1091724059

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1091724054 1091724059
Species Human (GRCh38) Human (GRCh38)
Location 12:2833528-2833550 12:2833572-2833594
Sequence CCGGGGAGAAGCAGTTGGTGGAG CCAACCTGTCAGTACAGGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 342} {0: 1, 1: 0, 2: 0, 3: 14, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!