ID: 1091763445_1091763452

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1091763445 1091763452
Species Human (GRCh38) Human (GRCh38)
Location 12:3102926-3102948 12:3102975-3102997
Sequence CCCATCTTTTGAATGAGGAAGAT CCAGGCCACTTGCTGTTAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 529} {0: 1, 1: 0, 2: 2, 3: 8, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!