ID: 1091770043_1091770054

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1091770043 1091770054
Species Human (GRCh38) Human (GRCh38)
Location 12:3145649-3145671 12:3145700-3145722
Sequence CCAGCAGTCCTCTCTGCCAGGAT CTGTCCAGATGGCTGGGGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 287} {0: 1, 1: 0, 2: 3, 3: 28, 4: 389}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!