ID: 1091774543_1091774552

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1091774543 1091774552
Species Human (GRCh38) Human (GRCh38)
Location 12:3175830-3175852 12:3175877-3175899
Sequence CCGACCCTGGAATCAAACAGGGA AAAAATGAGCATTGATTTCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 154} {0: 1, 1: 0, 2: 4, 3: 56, 4: 684}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!