ID: 1091784022_1091784033

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1091784022 1091784033
Species Human (GRCh38) Human (GRCh38)
Location 12:3231539-3231561 12:3231564-3231586
Sequence CCATCCCATGCCCCATGCCAGCC CCCTAAAGAGGTCAACCTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 79, 4: 650} {0: 1, 1: 0, 2: 0, 3: 12, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!