ID: 1091785963_1091785971

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1091785963 1091785971
Species Human (GRCh38) Human (GRCh38)
Location 12:3243643-3243665 12:3243660-3243682
Sequence CCTCCTGCTGTCACCCTCCCTGG CCCTGGCTTCCTCTTCAGGGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 7, 3: 52, 4: 566} {0: 1, 1: 0, 2: 2, 3: 31, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!