ID: 1091788650_1091788656

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1091788650 1091788656
Species Human (GRCh38) Human (GRCh38)
Location 12:3258349-3258371 12:3258370-3258392
Sequence CCTTTCCATCCAGGGATATATTC TCTGGGGCCCAGAATCACCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 175} {0: 1, 1: 0, 2: 3, 3: 30, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!