ID: 1091790736_1091790742

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1091790736 1091790742
Species Human (GRCh38) Human (GRCh38)
Location 12:3270555-3270577 12:3270573-3270595
Sequence CCCCCCATACTGAGGCTAGGCCA GGCCAGGAAGCCCAAACAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 115} {0: 1, 1: 0, 2: 4, 3: 41, 4: 391}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!